Product Details
- SNP ID
-
rs115750927
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.4:183322379 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGGATAAAATCCATCCCAGGAGAGA[G/T]AGTAAAAGTCCAACAGATTGCATTG
- Phenotype
-
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CLDN22
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7688467] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CLDN22
- Gene Name
- claudin 22
There are no transcripts associated with this gene.
- Gene
- CLDN24
- Gene Name
- claudin 24
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_001185149.1 |
48 |
Silent Mutation |
CTA,CTC |
L16L |
NP_001172078.1 |
- Gene
- WWC2
- Gene Name
- WW and C2 domain containing 2
There are no transcripts associated with this gene.
View Full Product Details