Product Details

SNP ID
rs117748424
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.12:79774864 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AATTATCTTATGCAACTTTAATTAT[C/G]GTTGAGTACTATCAAGTGAAAACTG
Phenotype
MIM: 602021
Polymorphism
C/G, Transversion Substitution
Allele Nomenclature
Literature Links
PPP1R12A PubMed Links
Additional Information
For this assay, SNP(s) [rs34341780] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
PPP1R12A
Gene Name
protein phosphatase 1 regulatory subunit 12A
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001143885.1 4186 UTR 3 NP_001137357.1
NM_001143886.1 4186 UTR 3 NP_001137358.1
NM_001244990.1 4186 UTR 3 NP_001231919.1
NM_001244992.1 4186 UTR 3 NP_001231921.1
NM_002480.2 4186 UTR 3 NP_002471.1
XM_005268887.3 4186 UTR 3 XP_005268944.1
XM_011538374.1 4186 UTR 3 XP_011536676.1
XM_011538375.1 4186 UTR 3 XP_011536677.1
XM_011538376.2 4186 UTR 3 XP_011536678.1
XM_011538377.1 4186 UTR 3 XP_011536679.1
XM_011538378.2 4186 UTR 3 XP_011536680.1
XM_011538379.1 4186 UTR 3 XP_011536681.1
XM_011538380.1 4186 UTR 3 XP_011536682.1
XM_011538383.2 4186 UTR 3 XP_011536685.1
XM_011538384.1 4186 UTR 3 XP_011536686.1
XM_011538385.1 4186 UTR 3 XP_011536687.1
XM_017019323.1 4186 UTR 3 XP_016874812.1
XM_017019324.1 4186 UTR 3 XP_016874813.1
XM_017019325.1 4186 UTR 3 XP_016874814.1
XM_017019326.1 4186 UTR 3 XP_016874815.1
XM_017019327.1 4186 UTR 3 XP_016874816.1
XM_017019328.1 4186 UTR 3 XP_016874817.1
XM_017019329.1 4186 UTR 3 XP_016874818.1
XM_017019330.1 4186 Intron XP_016874819.1

View Full Product Details