Product Details

SNP ID

rs138288481

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.10:27186516 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CAGGAATACTGCTCAGCACCTGACT[A/G]TATCTGGATTTAGTCTGTAGCACAA

Phenotype

MIM: 616618 MIM: 608221

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ACBD5 PubMed Links

Additional Information

For this assay, SNP(s) [rs10741130] are located under a probe and SNP(s) [rs10764686] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ACBD5

Gene Name

acyl-CoA binding domain containing 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042473.3	3462	Intron			NP_001035938.1
NM_001271512.3	3462	Intron			NP_001258441.1
NM_001301251.1	3462	Intron			NP_001288180.1
NM_001301252.1	3462	Intron			NP_001288181.1
NM_001301253.1	3462	Intron			NP_001288182.1
NM_001301254.1	3462	Intron			NP_001288183.1
NM_145698.4	3462	Intron			NP_663736.2
XM_006717528.3	3462	Intron			XP_006717591.3
XM_006717530.3	3462	Intron			XP_006717593.1
XM_006717531.2	3462	Intron			XP_006717594.1
XM_006717535.2	3462	Intron			XP_006717598.1
XM_017016884.1	3462	Intron			XP_016872373.1
XM_017016885.1	3462	Intron			XP_016872374.1
XM_017016886.1	3462	Intron			XP_016872375.1
XM_017016887.1	3462	Intron			XP_016872376.1
XM_017016888.1	3462	Intron			XP_016872377.1
XM_017016889.1	3462	Intron			XP_016872378.1
XM_017016890.1	3462	Intron			XP_016872379.1
XM_017016891.1	3462	Intron			XP_016872380.1
XM_017016892.1	3462	Intron			XP_016872381.1
XM_017016893.1	3462	Intron			XP_016872382.1
XM_017016894.1	3462	Intron			XP_016872383.1
XM_017016895.1	3462	Intron			XP_016872384.1
XM_017016896.1	3462	Intron			XP_016872385.1
XM_017016897.1	3462	Intron			XP_016872386.1
XM_017016898.1	3462	Intron			XP_016872387.1
XM_017016899.1	3462	Intron			XP_016872388.1
XM_017016900.1	3462	Intron			XP_016872389.1
XM_017016901.1	3462	Intron			XP_016872390.1
XM_017016902.1	3462	Intron			XP_016872391.1
XM_017016903.1	3462	Intron			XP_016872392.1
XM_017016904.1	3462	Intron			XP_016872393.1
XM_017016905.1	3462	Intron			XP_016872394.1
XM_017016906.1	3462	Intron			XP_016872395.1
XM_017016907.1	3462	Intron			XP_016872396.1
XM_017016908.1	3462	Intron			XP_016872397.1

Gene

MASTL

Gene Name

microtubule associated serine/threonine kinase like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001172303.2	3462	Missense Mutation	ATA,GTA	I874V	NP_001165774.1
NM_001172304.2	3462	Missense Mutation	ATA,GTA	I835V	NP_001165775.1
NM_001320756.1	3462	Missense Mutation	ATA,GTA	I878V	NP_001307685.1
NM_001320757.1	3462	Missense Mutation	ATA,GTA	I879V	NP_001307686.1
NM_032844.4	3462	Missense Mutation	ATA,GTA	I873V	NP_116233.2
XM_005252631.3	3462	Missense Mutation	ATA,GTA	I836V	XP_005252688.1
XM_005252632.3	3462	Missense Mutation	ATA,GTA	I802V	XP_005252689.1
XM_006717519.3	3462	Missense Mutation	ATA,GTA	I845V	XP_006717582.1
XM_006717520.3	3462	Intron			XP_006717583.1
XM_011519751.2	3462	Missense Mutation	ATA,GTA	I542V	XP_011518053.1
XM_017016852.1	3462	Missense Mutation	ATA,GTA	I839V	XP_016872341.1
XM_017016853.1	3462	Missense Mutation	ATA,GTA	I830V	XP_016872342.1
XM_017016854.1	3462	Intron			XP_016872343.1
XM_017016855.1	3462	Intron			XP_016872344.1
XM_017016856.1	3462	Intron			XP_016872345.1

View Full Product Details