Product Details

SNP ID
rs142884935
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.10:97460230 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ATTCTGGGTCACTCAGGAGGCCCAT[C/G]AGCTGGAGAAAAAAGAGCCTTTGAG
Phenotype
MIM: 614777 MIM: 616750
Polymorphism
C/G, Transversion Substitution
Allele Nomenclature
Literature Links
MMS19 PubMed Links
Additional Information
For this assay, SNP(s) [rs11818837] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
MMS19
Gene Name
MMS19 homolog, cytosolic iron-sulfur assembly component
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001289403.1 3098 Silent Mutation CTC,CTG L781L NP_001276332.1
NM_001289404.1 3098 Silent Mutation CTC,CTG L665L NP_001276333.1
NM_001289405.1 3098 Silent Mutation CTC,CTG L824L NP_001276334.1
NM_022362.4 3098 Silent Mutation CTC,CTG L824L NP_071757.4
XM_005270035.2 3098 Silent Mutation CTC,CTG L666L XP_005270092.1
XM_005270041.1 3098 Silent Mutation CTC,CTG L623L XP_005270098.1
XM_006717944.3 3098 Silent Mutation CTC,CTG L823L XP_006718007.2
XM_006717945.2 3098 Silent Mutation CTC,CTG L460L XP_006718008.1
XM_011540062.1 3098 Silent Mutation CTC,CTG L623L XP_011538364.1
XM_011540063.2 3098 Silent Mutation CTC,CTG L409L XP_011538365.1
XM_017016515.1 3098 Silent Mutation CTC,CTG L863L XP_016872004.1
XM_017016516.1 3098 Silent Mutation CTC,CTG L862L XP_016872005.1
XM_017016517.1 3098 Silent Mutation CTC,CTG L820L XP_016872006.1
XM_017016518.1 3098 Silent Mutation CTC,CTG L780L XP_016872007.1
XM_017016519.1 3098 Silent Mutation CTC,CTG L765L XP_016872008.1
XM_017016520.1 3098 Silent Mutation CTC,CTG L726L XP_016872009.1
XM_017016521.1 3098 Silent Mutation CTC,CTG L725L XP_016872010.1
XM_017016522.1 3098 Silent Mutation CTC,CTG L666L XP_016872011.1
XM_017016523.1 3098 Silent Mutation CTC,CTG L666L XP_016872012.1
XM_017016524.1 3098 Silent Mutation CTC,CTG L665L XP_016872013.1
XM_017016525.1 3098 Silent Mutation CTC,CTG L460L XP_016872014.1
XM_017016526.1 3098 Silent Mutation CTC,CTG L460L XP_016872015.1
XM_017016527.1 3098 Silent Mutation CTC,CTG L460L XP_016872016.1
XM_017016528.1 3098 Silent Mutation CTC,CTG L460L XP_016872017.1
XM_017016529.1 3098 Silent Mutation CTC,CTG L460L XP_016872018.1
XM_017016530.1 3098 Silent Mutation CTC,CTG L460L XP_016872019.1
XM_017016531.1 3098 Silent Mutation CTC,CTG L460L XP_016872020.1
XM_017016532.1 3098 Silent Mutation CTC,CTG L460L XP_016872021.1
XM_017016533.1 3098 Silent Mutation CTC,CTG L459L XP_016872022.1
XM_017016534.1 3098 Silent Mutation CTC,CTG L408L XP_016872023.1
XM_017016535.1 3098 Silent Mutation CTC,CTG L408L XP_016872024.1
Gene
ZDHHC16
Gene Name
zinc finger DHHC-type containing 16
There are no transcripts associated with this gene.

View Full Product Details