Product Details

SNP ID: rs144051413
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:133381550 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCCTGTGAAGACCATCCACTGGAA[C/T]GGGTCCTTCCAGGAGGCAGCCTTTC
Phenotype: MIM: 602292 MIM: 615853
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ECHS1 PubMed Links

Gene Details

Gene: ECHS1
Gene Name: enoyl-CoA hydratase, short chain 1

There are no transcripts associated with this gene.

Gene: MIR3944
Gene Name: microRNA 3944

There are no transcripts associated with this gene.

Gene: PAOX
Gene Name: polyamine oxidase (exo-N4-amino)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152911.3	839	Silent Mutation	AAC,AAT	N253N	NP_690875.1
NM_207127.2	839	Silent Mutation	AAC,AAT	N253N	NP_997010.1
NM_207128.2	839	Silent Mutation	AAC,AAT	N253N	NP_997011.1

View Full Product Details