Product Details

SNP ID: rs148722357
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:73773352 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCCATCTGTAACGACTACATGACA[A/G]AAAAACTGTGGCGTCCCATGCACCT
Phenotype: MIM: 608842 MIM: 616932 MIM: 607185
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CHCHD1 PubMed Links

Gene Details

Gene: CHCHD1
Gene Name: coiled-coil-helix-coiled-coil-helix domain containing 1

There are no transcripts associated with this gene.

Gene: FUT11
Gene Name: fucosyltransferase 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284194.1	1030	Missense Mutation	AAA,GAA	K291E	NP_001271123.1
NM_173540.2	1030	Missense Mutation	AAA,GAA	K291E	NP_775811.2
XM_006717656.3	1030	Missense Mutation	AAA,GAA	K291E	XP_006717719.1

Gene: SEC24C
Gene Name: SEC24 homolog C, COPII coat complex component

There are no transcripts associated with this gene.

View Full Product Details