Product Details

SNP ID
rs143766862
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.11:47565691 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TCTTCTACCCGACGCTGCTCTACAC[C/G]CTGTTCCGCGGGAAGGTGCCGGGTC
Phenotype
MIM: 601074 MIM: 609538
Polymorphism
C/G, Transversion substitution
Allele Nomenclature
Literature Links
CELF1 PubMed Links

Gene Details

Gene
CELF1
Gene Name
CUGBP, Elav-like family member 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001025596.2 262 Intron NP_001020767.1
NM_001172639.1 262 Intron NP_001166110.1
NM_001172640.1 262 Intron NP_001166111.1
NM_006560.3 262 Intron NP_006551.1
NM_198700.2 262 Intron NP_941989.1
XM_011519848.2 262 Intron XP_011518150.1
XM_011519850.2 262 Intron XP_011518152.2
XM_011519852.2 262 Intron XP_011518154.1
XM_011519854.1 262 Intron XP_011518156.1
XM_011519855.1 262 Intron XP_011518157.1
XM_011519856.1 262 Intron XP_011518158.1
XM_011519857.1 262 Intron XP_011518159.1
XM_011519858.1 262 Intron XP_011518160.1
XM_011519859.1 262 Intron XP_011518161.1
XM_017017101.1 262 Intron XP_016872590.1
XM_017017102.1 262 Intron XP_016872591.1
XM_017017103.1 262 Intron XP_016872592.1
XM_017017104.1 262 Intron XP_016872593.1
XM_017017105.1 262 Intron XP_016872594.1
XM_017017106.1 262 Intron XP_016872595.1
XM_017017107.1 262 Intron XP_016872596.1
XM_017017108.1 262 Intron XP_016872597.1
XM_017017109.1 262 Intron XP_016872598.1
XM_017017110.1 262 Intron XP_016872599.1
XM_017017111.1 262 Intron XP_016872600.1
XM_017017112.1 262 Intron XP_016872601.1
XM_017017113.1 262 Intron XP_016872602.1
XM_017017114.1 262 Intron XP_016872603.1
XM_017017115.1 262 Intron XP_016872604.1
XM_017017116.1 262 Intron XP_016872605.1
XM_017017117.1 262 Intron XP_016872606.1
XM_017017118.1 262 Intron XP_016872607.1
XM_017017119.1 262 Intron XP_016872608.1
XM_017017120.1 262 Intron XP_016872609.1
XM_017017121.1 262 Intron XP_016872610.1
XM_017017122.1 262 Intron XP_016872611.1
XM_017017123.1 262 Intron XP_016872612.1
XM_017017124.1 262 Intron XP_016872613.1
XM_017017125.1 262 Intron XP_016872614.1
XM_017017126.1 262 Intron XP_016872615.1
XM_017017127.1 262 Intron XP_016872616.1
XM_017017128.1 262 Intron XP_016872617.1
XM_017017129.1 262 Intron XP_016872618.1
XM_017017130.1 262 Intron XP_016872619.1
XM_017017131.1 262 Intron XP_016872620.1
XM_017017132.1 262 Intron XP_016872621.1
XM_017017133.1 262 Intron XP_016872622.1
XM_017017134.1 262 Intron XP_016872623.1
XM_017017135.1 262 Intron XP_016872624.1
Gene
KBTBD4
Gene Name
kelch repeat and BTB domain containing 4
There are no transcripts associated with this gene.

Gene
PTPMT1
Gene Name
protein tyrosine phosphatase, mitochondrial 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001143984.1 262 Silent Mutation ACC,ACG T23T NP_001137456.1
NM_175732.2 262 Silent Mutation ACC,ACG T23T NP_783859.1

View Full Product Details