Product Details

SNP ID: rs144006108
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:47242845 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGAGGGCAGCCAGGCAGGCTGAGC[A/G]GCCAGGGGGCCTTGTCACTCTCGTT
Phenotype: MIM: 171650 MIM: 600811 MIM: 602423
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACP2 PubMed Links

Gene Details

Gene: ACP2
Gene Name: acid phosphatase 2, lysosomal

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001302489.1	1003	Missense Mutation	CCG,CTG	P311L	NP_001289418.1
NM_001302490.1	1003	Missense Mutation	CCG,CTG	P307L	NP_001289419.1
NM_001302491.1	1003	Missense Mutation	CCG,CTG	P276L	NP_001289420.1
NM_001302492.1	1003	Missense Mutation	CCG,CTG	P152L	NP_001289421.1
NM_001610.3	1003	Missense Mutation	CCG,CTG	P339L	NP_001601.1

Gene: DDB2
Gene Name: damage specific DNA binding protein 2

There are no transcripts associated with this gene.

Gene: NR1H3
Gene Name: nuclear receptor subfamily 1 group H member 3

There are no transcripts associated with this gene.

View Full Product Details