Product Details

SNP ID: rs145994155
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:67399634 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCAGTTGAAGCAGTCAGTGAAGGT[C/T]TTCCACAGTTTGATGTTGTAGCGTC
Phenotype: MIM: 176875 MIM: 603761 MIM: 610831
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC100130987 PubMed Links

Gene Details

Gene: LOC100130987
Gene Name: uncharacterized LOC100130987

There are no transcripts associated with this gene.

Gene: PPP1CA
Gene Name: protein phosphatase 1 catalytic subunit alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008709.1	606	Silent Mutation	AAA,AAG	K161K	NP_001008709.1
NM_002708.3	606	Silent Mutation	AAA,AAG	K150K	NP_002699.1
NM_206873.1	606	Silent Mutation	AAA,AAG	K106K	NP_996756.1

Gene: RAD9A
Gene Name: RAD9 checkpoint clamp component A

There are no transcripts associated with this gene.

Gene: TBC1D10C
Gene Name: TBC1 domain family member 10C

There are no transcripts associated with this gene.

View Full Product Details