Product Details

SNP ID: rs150476596
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64300949 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCGCGGCAGCTCCATGGAAATCA[A/G]TCTGGGGGAGAAGGACACTGCATCC
Phenotype: MIM: 601998 MIM: 605720
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ESRRA PubMed Links

Gene Details

Gene: ESRRA
Gene Name: estrogen related receptor alpha

There are no transcripts associated with this gene.

Gene: KCNK4
Gene Name: potassium two pore domain channel subfamily K member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317090.1	334	Intron			NP_001304019.1
NM_033310.2	334	Intron			NP_201567.1

Gene: KCNK4-TEX40
Gene Name: KCNK4-TEX40 readthrough

There are no transcripts associated with this gene.

Gene: TEX40
Gene Name: testis expressed 40

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039496.1	334	Missense Mutation	AAT,AGT	N105S	NP_001034585.1

View Full Product Details