Product Details

SNP ID: rs139105980
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57235577 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCAGCCTGGCTTAGAAGTCTGGCC[A/G]GTCCTTCTTCAGCTTCTTATAGTCA
Phenotype: MIM: 604637 MIM: 138450 MIM: 615521
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NDUFA4L2 PubMed Links

Gene Details

Gene: NDUFA4L2
Gene Name: NDUFA4, mitochondrial complex associated like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020142.3	1129	Missense Mutation			NP_064527.1
XM_005269033.2	1129	Missense Mutation			XP_005269090.1
XM_011538573.2	1129	Missense Mutation			XP_011536875.1

Gene: NXPH4
Gene Name: neurexophilin 4

There are no transcripts associated with this gene.

Gene: SHMT2
Gene Name: serine hydroxymethyltransferase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001166356.1	1129	Intron			NP_001159828.1
NM_001166357.1	1129	Intron			NP_001159829.1
NM_001166358.1	1129	Intron			NP_001159830.1
NM_001166359.1	1129	Intron			NP_001159831.1
NM_005412.5	1129	Intron			NP_005403.2
XM_011538675.2	1129	Intron			XP_011536977.1
XM_011538676.2	1129	Intron			XP_011536978.1
XM_011538677.2	1129	Intron			XP_011536979.1
XM_011538678.2	1129	Intron			XP_011536980.1

Gene: STAC3
Gene Name: SH3 and cysteine rich domain 3

There are no transcripts associated with this gene.

View Full Product Details