Product Details

SNP ID

rs139806342

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.12:57254886 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CGAAGGGAGGCATTTTGGGCAGCCA[A/G]GGGGCTGGGGAACACAGCCACAATG

Phenotype

MIM: 615521

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

R3HDM2 PubMed Links

Gene Details

Gene

R3HDM2

Gene Name

R3H domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_005268725.3	3128	Silent Mutation	CTG,TTG	L940L	XP_005268782.1
XM_011538031.1	3128	Silent Mutation	CTG,TTG	L1019L	XP_011536333.1
XM_011538033.1	3128	Silent Mutation	CTG,TTG	L1014L	XP_011536335.1
XM_011538035.1	3128	Silent Mutation	CTG,TTG	L1005L	XP_011536337.1
XM_011538036.1	3128	Silent Mutation	CTG,TTG	L1003L	XP_011536338.1
XM_011538037.1	3128	Silent Mutation	CTG,TTG	L997L	XP_011536339.1
XM_011538038.1	3128	Silent Mutation	CTG,TTG	L987L	XP_011536340.1
XM_011538039.1	3128	Silent Mutation	CTG,TTG	L985L	XP_011536341.1
XM_011538040.1	3128	Silent Mutation	CTG,TTG	L980L	XP_011536342.1
XM_011538042.2	3128	Silent Mutation	CTG,TTG	L1037L	XP_011536344.1
XM_017018998.1	3128	Silent Mutation	CTG,TTG	L1011L	XP_016874487.1
XM_017018999.1	3128	Silent Mutation	CTG,TTG	L1037L	XP_016874488.1
XM_017019000.1	3128	Silent Mutation	CTG,TTG	L982L	XP_016874489.1
XM_017019001.1	3128	Silent Mutation	CTG,TTG	L1029L	XP_016874490.1
XM_017019002.1	3128	Silent Mutation	CTG,TTG	L972L	XP_016874491.1
XM_017019003.1	3128	Silent Mutation	CTG,TTG	L964L	XP_016874492.1
XM_017019004.1	3128	Silent Mutation	CTG,TTG	L962L	XP_016874493.1
XM_017019005.1	3128	Silent Mutation	CTG,TTG	L1006L	XP_016874494.1
XM_017019006.1	3128	Silent Mutation	CTG,TTG	L1006L	XP_016874495.1
XM_017019007.1	3128	Silent Mutation	CTG,TTG	L1006L	XP_016874496.1
XM_017019008.1	3128	Silent Mutation	CTG,TTG	L953L	XP_016874497.1
XM_017019009.1	3128	Silent Mutation	CTG,TTG	L948L	XP_016874498.1
XM_017019010.1	3128	Intron			XP_016874499.1
XM_017019011.1	3128	Silent Mutation	CTG,TTG	L996L	XP_016874500.1
XM_017019012.1	3128	Silent Mutation	CTG,TTG	L942L	XP_016874501.1
XM_017019013.1	3128	Intron			XP_016874502.1
XM_017019014.1	3128	Silent Mutation	CTG,TTG	L988L	XP_016874503.1
XM_017019015.1	3128	Silent Mutation	CTG,TTG	L976L	XP_016874504.1
XM_017019016.1	3128	Silent Mutation	CTG,TTG	L974L	XP_016874505.1
XM_017019017.1	3128	Intron			XP_016874506.1
XM_017019018.1	3128	Silent Mutation	CTG,TTG	L972L	XP_016874507.1
XM_017019019.1	3128	Silent Mutation	CTG,TTG	L962L	XP_016874508.1
XM_017019020.1	3128	Silent Mutation	CTG,TTG	L910L	XP_016874509.1
XM_017019021.1	3128	Silent Mutation	CTG,TTG	L956L	XP_016874510.1
XM_017019022.1	3128	Intron			XP_016874511.1
XM_017019023.1	3128	Silent Mutation	CTG,TTG	L956L	XP_016874512.1
XM_017019024.1	3128	Silent Mutation	CTG,TTG	L956L	XP_016874513.1
XM_017019025.1	3128	Silent Mutation	CTG,TTG	L952L	XP_016874514.1
XM_017019026.1	3128	Silent Mutation	CTG,TTG	L930L	XP_016874515.1
XM_017019027.1	3128	Silent Mutation	CTG,TTG	L922L	XP_016874516.1
XM_017019028.1	3128	Silent Mutation	CTG,TTG	L922L	XP_016874517.1
XM_017019029.1	3128	Silent Mutation	CTG,TTG	L902L	XP_016874518.1
XM_017019030.1	3128	Silent Mutation	CTG,TTG	L667L	XP_016874519.1
XM_017019031.1	3128	Silent Mutation	CTG,TTG	L635L	XP_016874520.1
XM_017019032.1	3128	Silent Mutation	CTG,TTG	L601L	XP_016874521.1
XM_017019033.1	3128	Silent Mutation	CTG,TTG	L601L	XP_016874522.1

Gene

STAC3

Gene Name

SH3 and cysteine rich domain 3

There are no transcripts associated with this gene.

View Full Product Details