Product Details

SNP ID: rs141554370
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:47711761 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTTGAACTGCATTGCCAGCACATC[A/G]GGGTAAGAATCCCACTGTGGAGGGA
Phenotype: MIM: 606720 MIM: 611477
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ENDOU PubMed Links

Gene Details

Gene: ENDOU
Gene Name: endonuclease, poly(U) specific

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001172439.1	1146	Silent Mutation	CCC,CCT	P329P	NP_001165910.1
NM_001172440.1	1146	Silent Mutation	CCC,CCT	P266P	NP_001165911.1
NM_006025.3	1146	Silent Mutation	CCC,CCT	P288P	NP_006016.1

Gene: LOC105369748
Gene Name: uncharacterized LOC105369748

There are no transcripts associated with this gene.

Gene: RPAP3
Gene Name: RNA polymerase II associated protein 3

There are no transcripts associated with this gene.

View Full Product Details