Product Details

SNP ID: rs141999894
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24207162 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTGGTAGGGACTTAAAGTTGGAG[A/C]ACCTGTTGCTGGACAAGTGGGAGAA
Phenotype: MIM: 610051 MIM: 603171 MIM: 610711
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CHMP4A PubMed Links

Gene Details

Gene: CHMP4A
Gene Name: charged multivesicular body protein 4A

There are no transcripts associated with this gene.

Gene: MDP1
Gene Name: magnesium dependent phosphatase 1

There are no transcripts associated with this gene.

Gene: NEDD8
Gene Name: neural precursor cell expressed, developmentally down-regulated 8

There are no transcripts associated with this gene.

Gene: NEDD8-MDP1
Gene Name: NEDD8-MDP1 readthrough

There are no transcripts associated with this gene.

Gene: TSSK4
Gene Name: testis specific serine kinase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001184739.1	691	Missense Mutation	AAC,CAC	N163H	NP_001171668.1
NM_001308067.1	691	Missense Mutation	AAC,CAC	N77H	NP_001294996.1
NM_174944.3	691	Missense Mutation	AAC,CAC	N153H	NP_777604.2
XM_011536663.2	691	Missense Mutation	AAC,CAC	N87H	XP_011534965.1
XM_017021226.1	691	Missense Mutation	AAC,CAC	N153H	XP_016876715.1

View Full Product Details