Product Details

SNP ID: rs147817006
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:64550002 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TATGGCTTCCAGGGCGAGGCCATGT[A/G]CCGGGTGCCCGAGTTTTATGCGAGG
Phenotype: MIM: 140560
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HSPA2 PubMed Links

Gene Details

Gene: HSPA2
Gene Name: heat shock protein family A (Hsp70) member 2

There are no transcripts associated with this gene.

Gene: LOC102723809
Gene Name: uncharacterized LOC102723809

There are no transcripts associated with this gene.

Gene: PPP1R36
Gene Name: protein phosphatase 1 regulatory subunit 36

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_172365.2	69	Missense Mutation	TAC,TGC	Y2C	NP_758953.1
XM_005267354.3	69	Intron			XP_005267411.1
XM_005267355.3	69	UTR 5			XP_005267412.1
XM_011536468.2	69	Missense Mutation	TAC,TGC	Y2C	XP_011534770.1

View Full Product Details