Product Details

SNP ID: rs141765515
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:70524214 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGGGAGGTGTGACAAGCAGCGGGA[A/G]GCATGGATGTCTCCCTCTGGGTAGA
Phenotype: MIM: 606976 MIM: 605592
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: COG4 PubMed Links

Gene Details

Gene: COG4
Gene Name: component of oligomeric golgi complex 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195139.1		Intron			NP_001182068.1
NM_015386.2		Intron			NP_056201.2
XM_011522981.2		Intron			XP_011521283.1

Gene: SF3B3
Gene Name: splicing factor 3b subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012426.4		Intron			NP_036558.3

Gene: SNORD111B
Gene Name: small nucleolar RNA, C/D box 111B

There are no transcripts associated with this gene.

View Full Product Details