Product Details
- SNP ID
-
rs144085976
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:56670525 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTGCAGGTGGCTCCTGCGCCTGCGC[C/T]GGCTCCTGCAAGTGCAAAAAGTGCA
- Phenotype
-
MIM: 156353
MIM: 156354
MIM: 156355
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MT1G
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs9934181] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MT1G
- Gene Name
- metallothionein 1G
There are no transcripts associated with this gene.
- Gene
- MT1H
- Gene Name
- metallothionein 1H
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_005951.2 |
|
Intron |
|
|
NP_005942.1 |
- Gene
- MT1IP
- Gene Name
- metallothionein 1I, pseudogene
There are no transcripts associated with this gene.
View Full Product Details