Product Details

SNP ID: rs141970156
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7859371 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAATTCTGGGGGTGGGGTGCTTCT[A/G]TGTTCTCCAGGTGGGGGTTCTGGAG
Phenotype: MIM: 611577
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CYB5D1 PubMed Links

Gene Details

Gene: CYB5D1
Gene Name: cytochrome b5 domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_005256440.3		Intron			XP_005256497.1
XM_011523638.2		Intron			XP_011521940.1

Gene: KDM6B
Gene Name: lysine demethylase 6B

There are no transcripts associated with this gene.

Gene: NAA38
Gene Name: N(alpha)-acetyltransferase 38, NatC auxiliary subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011524037.2		Intron			XP_011522339.1
XM_017025225.1		Intron			XP_016880714.1
XM_017025226.1		Intron			XP_016880715.1

Gene: TMEM88
Gene Name: transmembrane protein 88

There are no transcripts associated with this gene.

View Full Product Details