Product Details

SNP ID

rs143018255

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.17:45169082 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CATGACTCTGGTGGTTCCCTGCCCC[C/T]GACACCGCGGATGGAGAGCCACTCA

Phenotype

MIM: 615695

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

HEXIM2 PubMed Links

Additional Information

For this assay, SNP(s) [rs34207107] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

HEXIM2

Gene Name

hexamethylene bisacetamide inducible 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303436.1	1253	Missense Mutation	CCG,CTG	P67L	NP_001290365.1
NM_001303437.1	1253	Missense Mutation	CCG,CTG	P45L	NP_001290366.1
NM_001303438.1	1253	Missense Mutation	CCG,CTG	P45L	NP_001290367.1
NM_001303439.1	1253	Missense Mutation	CCG,CTG	P45L	NP_001290368.1
NM_001303440.1	1253	Missense Mutation	CCG,CTG	P45L	NP_001290369.1
NM_001303441.1	1253	Missense Mutation	CCG,CTG	P45L	NP_001290370.1
NM_001303442.1	1253	Missense Mutation	CCG,CTG	P45L	NP_001290371.1
NM_001303443.1	1253	Missense Mutation	CCG,CTG	P45L	NP_001290372.1
NM_001303444.1	1253	Missense Mutation	CCG,CTG	P45L	NP_001290373.1
NM_144608.2	1253	Missense Mutation	CCG,CTG	P45L	NP_653209.1
XM_006721687.3	1253	Missense Mutation	CCG,CTG	P68L	XP_006721750.1
XM_011524306.2	1253	Missense Mutation	CCG,CTG	P45L	XP_011522608.1
XM_011524307.2	1253	Missense Mutation	CCG,CTG	P205L	XP_011522609.2
XM_011524308.2	1253	Missense Mutation	CCG,CTG	P206L	XP_011522610.2
XM_017024167.1	1253	Missense Mutation	CCG,CTG	P45L	XP_016879656.1
XM_017024168.1	1253	Missense Mutation	CCG,CTG	P45L	XP_016879657.1
XM_017024169.1	1253	Missense Mutation	CCG,CTG	P45L	XP_016879658.1
XM_017024170.1	1253	Missense Mutation	CCG,CTG	P45L	XP_016879659.1

Gene

LOC105371795

Gene Name

uncharacterized LOC105371795

There are no transcripts associated with this gene.

View Full Product Details