Product Details
- SNP ID
-
rs145917118
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:40994058 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GAGGAGCAGATGGTGGTGGCAGGCC[C/T]GGTGGGGACACTGCAGCCTCGAGAG
- Phenotype
-
MIM: 616679
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
KRT40
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2010201] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KRT40
- Gene Name
- keratin 40
There are no transcripts associated with this gene.
- Gene
- KRTAP3-2
- Gene Name
- keratin associated protein 3-2
There are no transcripts associated with this gene.
- Gene
- KRTAP3-3
- Gene Name
- keratin associated protein 3-3
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_033185.2 |
76 |
Missense Mutation |
AGG,GGG |
R14G |
NP_149441.1 |
View Full Product Details