Product Details

SNP ID: rs148673221
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:4951893 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCAGGGGCAACCCCACGGTGGAG[A/G]TGGACCTGCACACGGCCAAGGGTAA
Phenotype: MIM: 131370 MIM: 176610 MIM: 610431 MIM: 610056
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ENO3 PubMed Links

Gene Details

Gene: ENO3
Gene Name: enolase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193503.1	588	Intron			NP_001180432.1
NM_001976.4	588	Intron			NP_001967.3
NM_053013.3	588	Intron			NP_443739.3
XM_005256521.2	588	Missense Mutation	ATG,GTG	M31V	XP_005256578.1
XM_011523729.1	588	Missense Mutation	ATG,GTG	M22V	XP_011522031.1
XM_017024346.1	588	Missense Mutation	ATG,GTG	M22V	XP_016879835.1

Gene: PFN1
Gene Name: profilin 1

There are no transcripts associated with this gene.

Gene: RNF167
Gene Name: ring finger protein 167

There are no transcripts associated with this gene.

Gene: SPAG7
Gene Name: sperm associated antigen 7

There are no transcripts associated with this gene.

View Full Product Details