Product Details

SNP ID: rs150976338
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7560782 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGTCATAATTCCCCGGGCAAGGGC[A/G]AAACTTAACCTCTCTCCACATGGAA
Phenotype: MIM: 612844 MIM: 602695 MIM: 604472
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: SENP3 PubMed Links

Gene Details

Gene: SENP3
Gene Name: SUMO1/sentrin/SMT3 specific peptidase 3

There are no transcripts associated with this gene.

Gene: SENP3-EIF4A1
Gene Name: SENP3-EIF4A1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: TNFSF12
Gene Name: tumor necrosis factor superfamily member 12

There are no transcripts associated with this gene.

Gene: TNFSF12-TNFSF13
Gene Name: TNFSF12-TNFSF13 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_172089.3	1450	Silent Mutation	GCA,GCG	A314A	NP_742086.1

Gene: TNFSF13
Gene Name: tumor necrosis factor superfamily member 13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198622.1	1450	Silent Mutation	GCA,GCG	A207A	NP_001185551.1
NM_001198623.1	1450	Silent Mutation	GCA,GCG	A206A	NP_001185552.1
NM_001198624.1	1450	Silent Mutation	GCA,GCG	A189A	NP_001185553.1
NM_003808.3	1450	Silent Mutation	GCA,GCG	A234A	NP_003799.1
NM_172087.2	1450	Silent Mutation	GCA,GCG	A218A	NP_742084.1
NM_172088.2	1450	Silent Mutation	GCA,GCG	A234A	NP_742085.1

View Full Product Details