Product Details

SNP ID
rs144905789
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.18:50269416 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ACAAGAGACATTTTGCTTGATAACC[A/G]GAGGGCGGAAGTGAAGCAGCAGCAC
Phenotype
MIM: 614759 MIM: 156535
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
CFAP53 PubMed Links

Gene Details

Gene
CFAP53
Gene Name
cilia and flagella associated protein 53
There are no transcripts associated with this gene.

Gene
MBD1
Gene Name
methyl-CpG binding domain protein 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001204136.1 2411 UTR 3 NP_001191065.1
NM_001204137.1 2411 Intron NP_001191066.1
NM_001204138.1 2411 Intron NP_001191067.1
NM_001204139.1 2411 Intron NP_001191068.1
NM_001204140.1 2411 Intron NP_001191069.1
NM_001204141.1 2411 Intron NP_001191070.1
NM_001204142.1 2411 UTR 3 NP_001191071.1
NM_001204143.1 2411 UTR 3 NP_001191072.1
NM_001204151.2 2411 UTR 3 NP_001191080.1
NM_001323942.1 2411 UTR 3 NP_001310871.1
NM_001323947.1 2411 UTR 3 NP_001310876.1
NM_001323949.1 2411 UTR 3 NP_001310878.1
NM_001323950.1 2411 UTR 3 NP_001310879.1
NM_001323951.1 2411 Intron NP_001310880.1
NM_001323952.1 2411 UTR 3 NP_001310881.1
NM_001323953.1 2411 Intron NP_001310882.1
NM_001323954.1 2411 UTR 3 NP_001310883.1
NM_002384.2 2411 UTR 3 NP_002375.1
NM_015844.2 2411 UTR 3 NP_056669.2
NM_015845.3 2411 UTR 3 NP_056670.2
NM_015846.3 2411 UTR 3 NP_056671.2
NM_015847.3 2411 UTR 3 NP_056723.2
XM_005258271.2 2411 UTR 3 XP_005258328.1
XM_006722456.2 2411 UTR 3 XP_006722519.1
XM_011525991.1 2411 UTR 3 XP_011524293.1
XM_011525993.2 2411 UTR 3 XP_011524295.1
XM_011525994.2 2411 UTR 3 XP_011524296.1
XM_011525998.2 2411 Intron XP_011524300.1
XM_011525999.1 2411 UTR 3 XP_011524301.1
XM_011526001.1 2411 UTR 3 XP_011524303.1
XM_011526002.1 2411 UTR 3 XP_011524304.1
XM_011526003.2 2411 UTR 3 XP_011524305.1
XM_011526006.1 2411 UTR 3 XP_011524308.1
XM_011526007.1 2411 UTR 3 XP_011524309.1
XM_017025751.1 2411 UTR 3 XP_016881240.1
XM_017025752.1 2411 UTR 3 XP_016881241.1
XM_017025753.1 2411 UTR 3 XP_016881242.1
XM_017025754.1 2411 Intron XP_016881243.1
XM_017025755.1 2411 Intron XP_016881244.1
XM_017025756.1 2411 UTR 3 XP_016881245.1
XM_017025757.1 2411 UTR 3 XP_016881246.1
XM_017025758.1 2411 UTR 3 XP_016881247.1
XM_017025759.1 2411 UTR 3 XP_016881248.1
XM_017025760.1 2411 UTR 3 XP_016881249.1
XM_017025761.1 2411 Intron XP_016881250.1
XM_017025762.1 2411 UTR 3 XP_016881251.1
XM_017025763.1 2411 UTR 3 XP_016881252.1
XM_017025764.1 2411 UTR 3 XP_016881253.1
XM_017025765.1 2411 UTR 3 XP_016881254.1
XM_017025766.1 2411 UTR 3 XP_016881255.1
XM_017025767.1 2411 UTR 3 XP_016881256.1
XM_017025768.1 2411 Intron XP_016881257.1
XM_017025769.1 2411 UTR 3 XP_016881258.1
XM_017025770.1 2411 UTR 3 XP_016881259.1
XM_017025771.1 2411 UTR 3 XP_016881260.1
XM_017025772.1 2411 Intron XP_016881261.1
XM_017025773.1 2411 UTR 3 XP_016881262.1
XM_017025774.1 2411 UTR 3 XP_016881263.1
XM_017025775.1 2411 Intron XP_016881264.1
XM_017025776.1 2411 UTR 3 XP_016881265.1
XM_017025777.1 2411 Intron XP_016881266.1

View Full Product Details