Product Details

SNP ID: rs150543128
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.18:46087107 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAAAGCAGTCAAGGAGCCACCACC[A/G]AAAGCATCGTTCATTTTGGCTGCTC
Phenotype: MIM: 164360
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: ATP5A1 PubMed Links
Additional Information: For this assay, SNP(s) [rs8097521] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: ATP5A1
Gene Name: ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001935.2	1199	Silent Mutation	TTC,TTT	F309F	NP_001001935.1
NM_001001937.1	1199	Silent Mutation	TTC,TTT	F359F	NP_001001937.1
NM_001257334.1	1199	Silent Mutation	TTC,TTT	F337F	NP_001244263.1
NM_001257335.1	1199	Silent Mutation	TTC,TTT	F309F	NP_001244264.1
NM_004046.5	1199	Silent Mutation	TTC,TTT	F359F	NP_004037.1
XM_017025789.1	1199	Silent Mutation	TTC,TTT	F359F	XP_016881278.1