Product Details

SNP ID: rs113077195
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54852135 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAAAGAAGACAGAAGCCACGTTCCC[A/T]TCTTCCACGGCAGAATATTCCAGGA
Phenotype: MIM: 604955 MIM: 604947
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: KIR2DS4 PubMed Links

Gene Details

Gene: KIR2DS4
Gene Name: killer cell immunoglobulin like receptor, two Ig domains and short cytoplasmic tail 4

There are no transcripts associated with this gene.

Gene: KIR3DL2
Gene Name: killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242867.1	365	Intron			NP_001229796.1
NM_006737.3	365	Intron			NP_006728.2
XM_011526940.2	365	Missense Mutation	ATC,TTC	I70F	XP_011525242.1
XM_017026784.1	365	Missense Mutation	ATC,TTC	I70F	XP_016882273.1

View Full Product Details