Product Details

SNP ID: rs143414819
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55343676 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACAGCCCTGCCCCCTGGCCTCTTG[G/T]CAGGAAAAAGAATGAGAAGCTGGAG
Phenotype: MIM: 613198
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: COX6B2 PubMed Links

Gene Details

Gene: COX6B2
Gene Name: cytochrome c oxidase subunit 6B2

There are no transcripts associated with this gene.

Gene: KMT5C
Gene Name: lysine methyltransferase 5C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032701.3	1432	Intron			NP_116090.2
XM_005259338.3	1432	Intron			XP_005259395.1
XM_006723442.3	1432	Intron			XP_006723505.1
XM_011527415.2	1432	Intron			XP_011525717.1
XM_017027388.1	1432	UTR 5			XP_016882877.1

Gene: TMEM150B
Gene Name: transmembrane protein 150B

There are no transcripts associated with this gene.

View Full Product Details