Product Details
- SNP ID
-
rs145122767
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:2249355 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACGATGCGGGACCTGCCTCTCACCA[C/G]CCTGGCCCTAGTGCTGTCTGCCCTG
- Phenotype
-
MIM: 600957
MIM: 608743
MIM: 600796
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
AMH
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs139215834] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- AMH
- Gene Name
- anti-Mullerian hormone
There are no transcripts associated with this gene.
- Gene
- JSRP1
- Gene Name
- junctional sarcoplasmic reticulum protein 1
There are no transcripts associated with this gene.
- Gene
- MIR4321
- Gene Name
- microRNA 4321
There are no transcripts associated with this gene.
- Gene
- SF3A2
- Gene Name
- splicing factor 3a subunit 2
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_007165.4 |
|
Intron |
|
|
NP_009096.2 |
View Full Product Details