Product Details
- SNP ID
-
rs147212550
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:55651391 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GAGTCAGCAGCCTCCTCCCTCAGCG[A/G]AGCGTCCGAAGAAGGCAGCGCCAGT
- Phenotype
-
MIM: 613478
MIM: 191318
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC106
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2287791] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC106
- Gene Name
- coiled-coil domain containing 106
- Gene
- U2AF2
- Gene Name
- U2 small nuclear RNA auxiliary factor 2
There are no transcripts associated with this gene.
- Gene
- ZNF580
- Gene Name
- zinc finger protein 580
There are no transcripts associated with this gene.
- Gene
- ZNF581
- Gene Name
- zinc finger protein 581
There are no transcripts associated with this gene.
View Full Product Details