Product Details

SNP ID: rs150102389
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:11345592 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCAGTAGATGGACCATCTTAATCA[C/G]GCCTCCTAGGTTCCCGCCTTCCTCC
Phenotype: MIM: 604350 MIM: 613771
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CCDC159 PubMed Links

Gene Details

Gene: CCDC159
Gene Name: coiled-coil domain containing 159

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080503.2	421	Intron			NP_001073972.2
XM_006722643.1	421	Intron			XP_006722706.1
XM_011527678.2	421	Intron			XP_011525980.2
XM_017026255.1	421	Intron			XP_016881744.1
XM_017026256.1	421	Intron			XP_016881745.1
XM_017026257.1	421	Intron			XP_016881746.1
XM_017026258.1	421	Intron			XP_016881747.1
XM_017026259.1	421	Intron			XP_016881748.1
XM_017026260.1	421	Intron			XP_016881749.1
XM_017026261.1	421	Intron			XP_016881750.1
XM_017026262.1	421	Intron			XP_016881751.1
XM_017026263.1	421	Intron			XP_016881752.1
XM_017026264.1	421	Intron			XP_016881753.1

Gene: PLPPR2
Gene Name: phospholipid phosphatase related 2

There are no transcripts associated with this gene.

Gene: RAB3D
Gene Name: RAB3D, member RAS oncogene family

There are no transcripts associated with this gene.

Gene: TMEM205
Gene Name: transmembrane protein 205

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145416.1	421	Missense Mutation	CTG,GTG	L10V	NP_001138888.1
NM_001321112.1	421	Missense Mutation	CTG,GTG	L10V	NP_001308041.1
NM_001321113.1	421	Missense Mutation	CTG,GTG	L10V	NP_001308042.1
NM_001321114.1	421	Missense Mutation	CTG,GTG	L10V	NP_001308043.1
NM_033408.3	421	Missense Mutation	CTG,GTG	L10V	NP_212133.1
NM_198536.2	421	Missense Mutation	CTG,GTG	L10V	NP_940938.1
XM_005259899.2	421	Missense Mutation	CTG,GTG	L10V	XP_005259956.1
XM_017026769.1	421	Intron			XP_016882258.1

View Full Product Details