Product Details
- SNP ID
-
rs150172701
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:52951142 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GTATTTGTGTGAATGAAGAATGGAG[A/G]AAATTCTTCCCATACTTATTAGAAA
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ZNF321P
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs57088011] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ZNF321P
- Gene Name
- zinc finger protein 321, pseudogene
There are no transcripts associated with this gene.
- Gene
- ZNF816
- Gene Name
- zinc finger protein 816
- Gene
- ZNF816-ZNF321P
- Gene Name
- ZNF816-ZNF321P readthrough
View Full Product Details