Product Details

SNP ID: rs150305828
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54866414 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAGCCTGCGGGGGACAGAACAGTG[A/C]ATAGGCAGGTAGGTCCTCCTCGGCC
Phenotype: MIM: 147045 MIM: 604947
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FCAR PubMed Links

Gene Details

Gene: FCAR
Gene Name: Fc fragment of IgA receptor

There are no transcripts associated with this gene.

Gene: KIR3DL2
Gene Name: killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242867.1	1202	Intron			NP_001229796.1
NM_006737.3	1202	Intron			NP_006728.2
XM_011526940.2	1202	Missense Mutation	AAT,CAT	N349H	XP_011525242.1
XM_017026784.1	1202	Intron			XP_016882273.1

View Full Product Details