Product Details

SNP ID: rs112401439
Assay Type: Functionally tested
NCBI dbSNP Submissions: 12
Location: Chr.1:228089546 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGTGGTGTTTCCCCTCAGCCTAC[A/G]TTTTTAAAATGAACGTTTCTTGAAG
Phenotype: MIM: 103180
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARF1 PubMed Links

Gene Details

Gene: ARF1
Gene Name: ADP ribosylation factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024226.1		Intron			NP_001019397.1
NM_001024227.1		Intron			NP_001019398.1
NM_001024228.1		Intron			NP_001019399.1
NM_001658.3		Intron			NP_001649.1
XM_017001233.1		Intron			XP_016856722.1

Gene: LOC100506571
Gene Name: uncharacterized LOC100506571

There are no transcripts associated with this gene.

Gene: MIR3620
Gene Name: microRNA 3620

There are no transcripts associated with this gene.

View Full Product Details