Product Details

SNP ID: rs114553184
Assay Type: Functionally tested
NCBI dbSNP Submissions: 18
Location: Chr.1:25832097 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAATAGCTGCCTTCCTCACCGCAG[A/G]TGTTTCTGCCTCTTAAGGATAGATC
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AUNIP PubMed Links

Gene Details

Gene: AUNIP
Gene Name: aurora kinase A and ninein interacting protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001287490.1	1160	Silent Mutation	CAC,CAT	H369H	NP_001274419.1
NM_024037.2	1160	Intron			NP_076942.1
XM_017002300.1	1160	Intron			XP_016857789.1

Gene: LOC646471
Gene Name: uncharacterized LOC646471

There are no transcripts associated with this gene.

Gene: MTFR1L
Gene Name: mitochondrial fission regulator 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099625.1	1160	UTR 3			NP_001093095.1
NM_001099626.1	1160	UTR 3			NP_001093096.1
NM_001099627.1	1160	UTR 3			NP_001093097.1
NM_019557.5	1160	UTR 3			NP_062457.3

View Full Product Details