Product Details

SNP ID: rs121434405
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:92833452 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGATACCAAGTGAAATTTAGAAGA[C/T]GACGAGGTACTGTCACCTTTTTGTG
Phenotype: MIM: 614542 MIM: 603634 MIM: 603635
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM69A PubMed Links

Gene Details

Gene: FAM69A
Gene Name: family with sequence similarity 69 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001006605.4	145	Intron			NP_001006606.2
NM_001252269.1	145	Intron			NP_001239198.1
NM_001252270.1	145	Intron			NP_001239199.1
NM_001252271.1	145	Intron			NP_001239200.1
NM_001252273.1	145	Intron			NP_001239202.1

Gene: RPL5
Gene Name: ribosomal protein L5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000969.3	145	Nonsense Mutation			NP_000960.2

Gene: SNORA66
Gene Name: small nucleolar RNA, H/ACA box 66

There are no transcripts associated with this gene.

Gene: SNORD21
Gene Name: small nucleolar RNA, C/D box 21

There are no transcripts associated with this gene.

View Full Product Details