Product Details

SNP ID: rs138709620
Assay Type: Functionally tested
NCBI dbSNP Submissions: 13
Location: Chr.1:2591614 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATGGATTGGATGGCGAACTCGGGC[C/T]GGTAGGACCCGCACCACACCTGTGG
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM213B PubMed Links

Gene Details

Gene: FAM213B
Gene Name: family with sequence similarity 213 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195736.1	2663	Intron			NP_001182665.1
NM_001195737.1	2663	Intron			NP_001182666.1
NM_001195738.1	2663	Intron			NP_001182667.1
NM_001195740.1	2663	Intron			NP_001182669.1
NM_001195741.1	2663	Intron			NP_001182670.1
NM_152371.3	2663	Intron			NP_689584.2
XM_006710354.3	2663	Intron			XP_006710417.1
XM_011540664.1	2663	Intron			XP_011538966.1
XM_011540665.1	2663	Intron			XP_011538967.1
XM_011540666.1	2663	Intron			XP_011538968.1

Gene: LOC100996583
Gene Name: uncharacterized LOC100996583

There are no transcripts associated with this gene.

Gene: MMEL1
Gene Name: membrane metallo-endopeptidase-like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033467.3	2663	Missense Mutation	CAG,CGG	Q728R	NP_258428.2
XM_011542122.2	2663	Missense Mutation	CAG,CGG	Q471R	XP_011540424.1
XM_017002310.1	2663	Missense Mutation	CAG,CGG	Q728R	XP_016857799.1
XM_017002311.1	2663	Missense Mutation	CAG,CGG	Q710R	XP_016857800.1
XM_017002312.1	2663	Missense Mutation	CAG,CGG	Q702R	XP_016857801.1
XM_017002313.1	2663	Missense Mutation	CAG,CGG	Q696R	XP_016857802.1
XM_017002314.1	2663	Missense Mutation	CAG,CGG	Q685R	XP_016857803.1
XM_017002315.1	2663	Missense Mutation	CAG,CGG	Q624R	XP_016857804.1

View Full Product Details