Product Details

SNP ID: rs145371506
Assay Type: Functionally tested
NCBI dbSNP Submissions: 17
Location: Chr.1:3890748 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGTTGGATTCTTCTGCTCCGGACC[C/T]GGCACTGTGTTTTGGCACGGACAGG
Phenotype: MIM: 601883
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C1orf174 PubMed Links

Gene Details

Gene: C1orf174
Gene Name: chromosome 1 open reading frame 174

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_207356.2	3034	Missense Mutation	AGG,GGG	R147G	NP_997239.2
XM_005244743.3	3034	Missense Mutation	AGG,GGG	R158G	XP_005244800.1
XM_011541323.2	3034	Missense Mutation	AGG,GGG	R158G	XP_011539625.1

Gene: DFFB
Gene Name: DNA fragmentation factor subunit beta

There are no transcripts associated with this gene.

Gene: LINC01134
Gene Name: long intergenic non-protein coding RNA 1134

There are no transcripts associated with this gene.

View Full Product Details