Product Details

SNP ID: rs148588192
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:2592718 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTCCCCAAGGGTGTTGAATCCGTT[C/G]ACCTGCGCACAGGAGACAGGATTGG
Phenotype
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FAM213B PubMed Links

Gene Details

Gene: FAM213B
Gene Name: family with sequence similarity 213 member B

There are no transcripts associated with this gene.

Gene: LOC100996583
Gene Name: uncharacterized LOC100996583

There are no transcripts associated with this gene.

Gene: MMEL1
Gene Name: membrane metallo-endopeptidase-like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033467.3	2484	Silent Mutation	GTC,GTG	V668V	NP_258428.2
XM_011542122.2	2484	Silent Mutation	GTC,GTG	V411V	XP_011540424.1
XM_017002310.1	2484	Silent Mutation	GTC,GTG	V668V	XP_016857799.1
XM_017002311.1	2484	Silent Mutation	GTC,GTG	V650V	XP_016857800.1
XM_017002312.1	2484	Silent Mutation	GTC,GTG	V642V	XP_016857801.1
XM_017002313.1	2484	Silent Mutation	GTC,GTG	V668V	XP_016857802.1
XM_017002314.1	2484	Silent Mutation	GTC,GTG	V625V	XP_016857803.1
XM_017002315.1	2484	Silent Mutation	GTC,GTG	V564V	XP_016857804.1

View Full Product Details