Product Details

SNP ID: rs149111256
Assay Type: Functionally tested
NCBI dbSNP Submissions: 6
Location: Chr.1:1918162 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGTGGGTACTGCACGGAGCTGTAG[C/G]CTGCAGGGAACCAGAGTGGGTTCGT
Phenotype: MIM: 610171
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CALML6 PubMed Links

Gene Details

Gene: CALML6
Gene Name: calmodulin like 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_005244729.3	386	Intron			XP_005244786.2
XM_011540841.2	386	Intron			XP_011539143.1

Gene: CFAP74
Gene Name: cilia and flagella associated protein 74

There are no transcripts associated with this gene.

Gene: TMEM52
Gene Name: transmembrane protein 52

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_178545.3	386	Missense Mutation	TCC,TGC	S117C	NP_848640.1

View Full Product Details