Product Details

SNP ID: rs139136543
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45887560 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTGGCCGGAAGGCAGAGGACCTG[A/G]ATGAGTTTGTGGAGTCCTGAAGTAG
Phenotype: MIM: 613111 MIM: 608597
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CTSA PubMed Links

Gene Details

Gene: CTSA
Gene Name: cathepsin A

There are no transcripts associated with this gene.

Gene: NEURL2
Gene Name: neuralized E3 ubiquitin protein ligase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278535.1	40	Intron			NP_001265464.1
NM_080749.3	40	Intron			NP_542787.1

Gene: SPATA25
Gene Name: spermatogenesis associated 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_080608.3	40	Missense Mutation	CCA,TCA	P11S	NP_542175.1

Gene: ZSWIM1
Gene Name: zinc finger SWIM-type containing 1

There are no transcripts associated with this gene.

Gene: ZSWIM3
Gene Name: zinc finger SWIM-type containing 3

There are no transcripts associated with this gene.

View Full Product Details