Product Details

SNP ID

rs144586846

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.20:3228365 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGCAGCAGCTGAAGCACCTGCAGGC[C/T]CGTGAAGTAGTGGATCTTCCTCTGG

Phenotype

MIM: 147520 MIM: 610206

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

ITPA PubMed Links

Additional Information

For this assay, SNP(s) [rs58757394] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ITPA

Gene Name

inosine triphosphatase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267623.1	2575	Intron			NP_001254552.1
NM_001324236.1	2575	Intron			NP_001311165.1
NM_001324237.1	2575	Intron			NP_001311166.1
NM_001324238.1	2575	Intron			NP_001311167.1
NM_001324240.1	2575	Intron			NP_001311169.1
NM_033453.3	2575	Intron			NP_258412.1
NM_181493.3	2575	Intron			NP_852470.1
XM_006723564.3	2575	Intron			XP_006723627.1
XM_006723565.3	2575	Intron			XP_006723628.1
XM_011529234.2	2575	Intron			XP_011527536.1

Gene

SLC4A11

Gene Name

solute carrier family 4 member 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001174089.1	2575	Missense Mutation	AGC,GGC	S818G	NP_001167560.1
NM_001174090.1	2575	Missense Mutation	AGC,GGC	S861G	NP_001167561.1
NM_032034.3	2575	Missense Mutation	AGC,GGC	S834G	NP_114423.1
XM_005260856.4	2575	Missense Mutation	AGC,GGC	S941G	XP_005260913.1
XM_005260857.1	2575	Missense Mutation	AGC,GGC	S799G	XP_005260914.1
XM_011529383.2	2575	Missense Mutation	AGC,GGC	S807G	XP_011527685.1
XM_011529384.1	2575	Missense Mutation	AGC,GGC	S799G	XP_011527686.1
XM_011529385.1	2575	Missense Mutation	AGC,GGC	S799G	XP_011527687.1
XM_017028093.1	2575	Missense Mutation	AGC,GGC	S939G	XP_016883582.1
XM_017028094.1	2575	Missense Mutation	AGC,GGC	S799G	XP_016883583.1
XM_017028095.1	2575	Missense Mutation	AGC,GGC	S780G	XP_016883584.1
XM_017028096.1	2575	Missense Mutation	AGC,GGC	S799G	XP_016883585.1
XM_017028097.1	2575	Intron			XP_016883586.1

View Full Product Details