Product Details
- SNP ID
-
rs141647980
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:30380111 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCACACCGCACAGGTCTCAGCACCC[A/G]GATCTGGGAGGCCCTGCGCTGCCCT
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC157
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs5749088] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC157
- Gene Name
- coiled-coil domain containing 157
There are no transcripts associated with this gene.
- Gene
- KIAA1656
- Gene Name
- KIAA1656 protein
There are no transcripts associated with this gene.
- Gene
- RNF215
- Gene Name
- ring finger protein 215
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001017981.1 |
959 |
Missense Mutation |
CCG,CTG |
P320L |
NP_001017981.1 |
View Full Product Details