Product Details

SNP ID: rs145509871
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27222235 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTGACCAAGAAGTTGCGGGAACAG[A/G]GGTCTCTGCTGGGGAAGCTGGTCCA
Phenotype: MIM: 114010 MIM: 604024
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATRAID PubMed Links

Gene Details

Gene: ATRAID
Gene Name: all-trans retinoic acid induced differentiation factor

There are no transcripts associated with this gene.

Gene: CAD
Gene Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001306079.1	556	Missense Mutation	AGG,GGG	R132G	NP_001293008.1
NM_004341.4	556	Missense Mutation	AGG,GGG	R132G	NP_004332.2
XM_005264555.3	556	Missense Mutation	AGG,GGG	R132G	XP_005264612.1
XM_006712101.2	556	Missense Mutation	AGG,GGG	R132G	XP_006712164.1

Gene: SLC5A6
Gene Name: solute carrier family 5 member 6

There are no transcripts associated with this gene.

View Full Product Details