Product Details

SNP ID: rs141012828
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:184344570 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCACCGGTTCTCCCGGCCTGTGC[A/G]CCAGGGCTCCGTGGAGCCTGAGAGC
Phenotype: MIM: 600570 MIM: 600495
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CLCN2 PubMed Links

Gene Details

Gene: CLCN2
Gene Name: chloride voltage-gated channel 2

There are no transcripts associated with this gene.

Gene: EIF4G1
Gene Name: eukaryotic translation initiation factor 4 gamma 1

There are no transcripts associated with this gene.

Gene: FAM131A
Gene Name: family with sequence similarity 131 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001171093.1	912	Missense Mutation	CAC,CGC	H149R	NP_001164564.1
NM_144635.4	912	Missense Mutation	CAC,CGC	H234R	NP_653236.3
XM_005247113.2	912	Missense Mutation	CAC,CGC	H149R	XP_005247170.1
XM_005247114.3	912	Missense Mutation	CAC,CGC	H149R	XP_005247171.1
XM_011512413.2	912	Missense Mutation	CAC,CGC	H149R	XP_011510715.1

View Full Product Details