Product Details

SNP ID: rs142714553
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:160402786 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAAAATAAGATCTAAAAAACTCTC[A/G]GTATTAATACATAATTCTGATGAAC
Phenotype: MIM: 611177 MIM: 605575
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IFT80 PubMed Links

Gene Details

Gene: IFT80
Gene Name: intraflagellar transport 80

There are no transcripts associated with this gene.

Gene: MIR15B
Gene Name: microRNA 15b

There are no transcripts associated with this gene.

Gene: MIR16-2
Gene Name: microRNA 16-2

There are no transcripts associated with this gene.

Gene: SMC4
Gene Name: structural maintenance of chromosomes 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002800.2	650	Silent Mutation	TCA,TCG	S143S	NP_001002800.1
NM_001288753.1	650	Silent Mutation	TCA,TCG	S118S	NP_001275682.1
NM_005496.3	650	Silent Mutation	TCA,TCG	S143S	NP_005487.3
XM_006713459.3	650	Silent Mutation	TCA,TCG	S143S	XP_006713522.1
XM_011512311.2	650	Silent Mutation	TCA,TCG	S143S	XP_011510613.1
XM_011512312.2	650	Silent Mutation	TCA,TCG	S71S	XP_011510614.1
XM_017005491.1	650	UTR 5			XP_016860980.1

View Full Product Details