Product Details

SNP ID

rs140911710

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.5:179617100 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTGTAGAATTCAAGAAGAGTTCTAC[A/G]TATCTGTGTTCTGAAATGAGAAAAA

Phenotype

MIM: 601035 MIM: 610327

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

HNRNPH1 PubMed Links

Gene Details

Gene

HNRNPH1

Gene Name

heterogeneous nuclear ribonucleoprotein H1 (H)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001257293.1	1023	Silent Mutation	TAC,TAT	Y356Y	NP_001244222.1
NM_005520.2	1023	Intron			NP_005511.1
XM_005265895.2	1023	Silent Mutation	TAC,TAT	Y356Y	XP_005265952.1
XM_005265896.2	1023	Silent Mutation	TAC,TAT	Y356Y	XP_005265953.1
XM_005265901.1	1023	Silent Mutation	TAC,TAT	Y155Y	XP_005265958.1
XM_005265902.4	1023	Silent Mutation	TAC,TAT	Y155Y	XP_005265959.1
XM_006714862.2	1023	Silent Mutation	TAC,TAT	Y356Y	XP_006714925.1
XM_006714863.2	1023	Silent Mutation	TAC,TAT	Y356Y	XP_006714926.1
XM_011534542.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_011532844.1
XM_011534544.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_011532846.1
XM_011534545.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_011532847.1
XM_011534546.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_011532848.1
XM_011534547.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_011532849.1
XM_017009414.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_016864903.1
XM_017009415.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_016864904.1
XM_017009416.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_016864905.1
XM_017009417.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_016864906.1
XM_017009418.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_016864907.1
XM_017009419.1	1023	Silent Mutation	TAC,TAT	Y356Y	XP_016864908.1
XM_017009420.1	1023	Silent Mutation	TAC,TAT	Y155Y	XP_016864909.1
XM_017009421.1	1023	Silent Mutation	TAC,TAT	Y155Y	XP_016864910.1
XM_017009422.1	1023	Silent Mutation	TAC,TAT	Y155Y	XP_016864911.1
XM_017009423.1	1023	Silent Mutation	TAC,TAT	Y155Y	XP_016864912.1
XM_017009424.1	1023	Silent Mutation	TAC,TAT	Y193Y	XP_016864913.1
XM_017009425.1	1023	Intron			XP_016864914.1

Gene

RUFY1

Gene Name

RUN and FYVE domain containing 1

There are no transcripts associated with this gene.

View Full Product Details