Product Details

SNP ID: rs150139635
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:132866926 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATCTGACGCGGATGCGGCATGTGAT[C/T]AGCTACAGCTTGTCACCGTTCGAGC
Phenotype: MIM: 604417 MIM: 601918 MIM: 611373 MIM: 612080
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AFF4 PubMed Links

Gene Details

Gene: AFF4
Gene Name: AF4/FMR2 family member 4

There are no transcripts associated with this gene.

Gene: GDF9
Gene Name: growth differentiation factor 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001288824.2	119	Intron			NP_001275753.1
NM_001288825.2	119	Intron			NP_001275754.1
NM_001288826.2	119	Intron			NP_001275755.1
NM_001288827.2	119	Intron			NP_001275756.1
NM_001288828.2	119	Intron			NP_001275757.1
XM_005271957.4	119	Intron			XP_005272014.1
XM_006714585.3	119	Intron			XP_006714648.1
XM_011543308.2	119	Intron			XP_011541610.1
XM_011543309.1	119	Intron			XP_011541611.1
XM_011543310.1	119	Intron			XP_011541612.1
XM_011543311.2	119	Intron			XP_011541613.1

Gene: LEAP2
Gene Name: liver enriched antimicrobial peptide 2

There are no transcripts associated with this gene.

Gene: UQCRQ
Gene Name: ubiquinol-cytochrome c reductase complex III subunit VII

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014402.4	119	Silent Mutation	ATC,ATT	I15I	NP_055217.2

View Full Product Details