Product Details

SNP ID
rs138070617
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.6:26385028 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CTTGTTGAACAGCCCAGTTTACTGT[C/T]GTGGGGCCAGCTAATCCCATCCTGG
Phenotype
MIM: 613591 MIM: 613594
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
BTN2A2 PubMed Links
Additional Information
For this assay, SNP(s) [rs61364019] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
BTN2A2
Gene Name
butyrophilin subfamily 2 member A2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001197237.1 210 Silent Mutation GTC,GTT V36V NP_001184166.1
NM_001197238.1 210 Silent Mutation GTC,GTT V36V NP_001184167.1
NM_001197239.1 210 Intron NP_001184168.1
NM_001197240.1 210 Silent Mutation GTC,GTT V36V NP_001184169.1
NM_006995.4 210 Silent Mutation GTC,GTT V36V NP_008926.2
NM_181531.2 210 Intron NP_853509.1
XM_005248797.3 210 Silent Mutation GTC,GTT V36V XP_005248854.1
XM_005248798.4 210 Intron XP_005248855.1
XM_006714953.3 210 Silent Mutation GTC,GTT V36V XP_006715016.1
XM_006714955.3 210 Silent Mutation GTC,GTT V36V XP_006715018.1
XM_011514228.2 210 Silent Mutation GTC,GTT V36V XP_011512530.1
XM_011514229.2 210 Silent Mutation GTC,GTT V36V XP_011512531.1
XM_011514231.2 210 Intron XP_011512533.1
XM_017010166.1 210 Silent Mutation GTC,GTT V36V XP_016865655.1
XM_017010167.1 210 Intron XP_016865656.1
XM_017010168.1 210 Silent Mutation GTC,GTT V36V XP_016865657.1
XM_017010169.1 210 Silent Mutation GTC,GTT V36V XP_016865658.1
Gene
BTN3A2
Gene Name
butyrophilin subfamily 3 member A2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001197246.2 210 Intron NP_001184175.1
NM_001197247.2 210 Intron NP_001184176.1
NM_001197248.2 210 Intron NP_001184177.1
NM_001197249.2 210 Intron NP_001184178.1
NM_007047.4 210 Intron NP_008978.2
XM_005248827.3 210 Intron XP_005248884.1
XM_005248831.3 210 Intron XP_005248888.1
XM_005248832.3 210 Intron XP_005248889.1
XM_006714979.3 210 Intron XP_006715042.1
XM_006714980.3 210 Intron XP_006715043.1
XM_006714981.3 210 Intron XP_006715044.1
XM_006714982.3 210 Intron XP_006715045.1
XM_011514267.2 210 Intron XP_011512569.1
XM_011514268.2 210 Intron XP_011512570.1
XM_011514269.2 210 Intron XP_011512571.1
XM_011514270.2 210 Intron XP_011512572.1
XM_011514271.2 210 Intron XP_011512573.1
XM_017010211.1 210 Intron XP_016865700.1
XM_017010212.1 210 Intron XP_016865701.1
XM_017010213.1 210 Intron XP_016865702.1
XM_017010214.1 210 Intron XP_016865703.1
XM_017010215.1 210 Intron XP_016865704.1
XM_017010216.1 210 Intron XP_016865705.1
XM_017010217.1 210 Intron XP_016865706.1

View Full Product Details