Product Details

SNP ID: rs147917111
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:159762130 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCTGTGGTCATCGTCTCGGCGGCG[A/C]GGACCATCATAGGTGAGTGGCCGGC
Phenotype: MIM: 100678 MIM: 147460 MIM: 605442
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ACAT2 PubMed Links

Gene Details

Gene: ACAT2
Gene Name: acetyl-CoA acetyltransferase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303253.1	400	Intron			NP_001290182.1
NM_005891.2	400	Silent Mutation	AGG,CGG	R15R	NP_005882.2

Gene: LOC100129518
Gene Name: uncharacterized LOC100129518

There are no transcripts associated with this gene.

Gene: SOD2
Gene Name: superoxide dismutase 2, mitochondrial

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000636.3	400	Intron			NP_000627.2
NM_001024465.2	400	Intron			NP_001019636.1
NM_001024466.2	400	Intron			NP_001019637.1
NM_001322814.1	400	Intron			NP_001309743.1
NM_001322815.1	400	Intron			NP_001309744.1
NM_001322816.1	400	Intron			NP_001309745.1
NM_001322817.1	400	UTR 5			NP_001309746.1
NM_001322819.1	400	Intron			NP_001309748.1
NM_001322820.1	400	Intron			NP_001309749.1

Gene: WTAP
Gene Name: Wilms tumor 1 associated protein

There are no transcripts associated with this gene.

View Full Product Details