Product Details

SNP ID: rs140387520
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:151062011 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCATGAGCAGCGCCCCTCGGCGCCC[C/T]GCCAAGGGCGCAGATTCTTTCTGTA
Phenotype: MIM: 611741 MIM: 123831 MIM: 109280
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ASIC3 PubMed Links

Gene Details

Gene: ASIC3
Gene Name: acid sensing ion channel subunit 3

There are no transcripts associated with this gene.

Gene: CDK5
Gene Name: cyclin dependent kinase 5

There are no transcripts associated with this gene.

Gene: SLC4A2
Gene Name: solute carrier family 4 member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199692.1	1064	Silent Mutation	CCC,CCT	P8P	NP_001186621.1
NM_001199693.1	1064	Intron			NP_001186622.1
NM_001199694.1	1064	Intron			NP_001186623.1
NM_003040.3	1064	Silent Mutation	CCC,CCT	P8P	NP_003031.3
XM_006716094.3	1064	Silent Mutation	CCC,CCT	P8P	XP_006716157.1

View Full Product Details