Product Details

SNP ID

rs148228353

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.7:148807676 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GGATTTCCATTTCTCTTTCGATGCC[A/G]ACATACTTCAGGGCATCAGCCTGGC

Phenotype

MIM: 603134 MIM: 601573

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

CUL1 PubMed Links

Additional Information

For this assay, SNP(s) [rs560966145] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

CUL1

Gene Name

cullin 1

There are no transcripts associated with this gene.

Gene

EZH2

Gene Name

enhancer of zeste 2 polycomb repressive complex 2 subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001203247.1	4745	Silent Mutation	GTC,GTT	V737V	NP_001190176.1
NM_001203248.1	4745	Silent Mutation	GTC,GTT	V728V	NP_001190177.1
NM_001203249.1	4745	Silent Mutation	GTC,GTT	V686V	NP_001190178.1
NM_004456.4	4745	Silent Mutation	GTC,GTT	V742V	NP_004447.2
NM_152998.2	4745	Silent Mutation	GTC,GTT	V698V	NP_694543.1
XM_005249962.4	4745	Silent Mutation	GTC,GTT	V745V	XP_005250019.1
XM_005249963.4	4745	Silent Mutation	GTC,GTT	V736V	XP_005250020.1
XM_005249964.4	4745	Silent Mutation	GTC,GTT	V694V	XP_005250021.1
XM_011515883.2	4745	Silent Mutation	GTC,GTT	V750V	XP_011514185.1
XM_011515884.2	4745	Silent Mutation	GTC,GTT	V742V	XP_011514186.1
XM_011515885.2	4745	Silent Mutation	GTC,GTT	V741V	XP_011514187.1
XM_011515886.2	4745	Silent Mutation	GTC,GTT	V734V	XP_011514188.1
XM_011515887.2	4745	Silent Mutation	GTC,GTT	V733V	XP_011514189.1
XM_011515888.2	4745	Silent Mutation	GTC,GTT	V733V	XP_011514190.1
XM_011515889.2	4745	Silent Mutation	GTC,GTT	V720V	XP_011514191.1
XM_011515890.2	4745	Silent Mutation	GTC,GTT	V711V	XP_011514192.1
XM_011515891.2	4745	Silent Mutation	GTC,GTT	V709V	XP_011514193.1
XM_011515892.2	4745	Silent Mutation	GTC,GTT	V708V	XP_011514194.1
XM_011515893.2	4745	Silent Mutation	GTC,GTT	V706V	XP_011514195.1
XM_011515894.2	4745	Silent Mutation	GTC,GTT	V703V	XP_011514196.1
XM_011515895.2	4745	Silent Mutation	GTC,GTT	V702V	XP_011514197.1
XM_011515896.2	4745	Silent Mutation	GTC,GTT	V664V	XP_011514198.1
XM_011515897.2	4745	Silent Mutation	GTC,GTT	V633V	XP_011514199.1
XM_011515898.2	4745	Silent Mutation	GTC,GTT	V633V	XP_011514200.1
XM_011515899.2	4745	Intron			XP_011514201.1
XM_011515901.2	4745	Intron			XP_011514203.1
XM_017011817.1	4745	Silent Mutation	GTC,GTT	V750V	XP_016867306.1
XM_017011818.1	4745	Silent Mutation	GTC,GTT	V729V	XP_016867307.1
XM_017011819.1	4745	Silent Mutation	GTC,GTT	V703V	XP_016867308.1
XM_017011820.1	4745	Silent Mutation	GTC,GTT	V694V	XP_016867309.1
XM_017011821.1	4745	Silent Mutation	GTC,GTT	V628V	XP_016867310.1

View Full Product Details